The modENCODE Project</title-seeking> <script type="text/javascript" src="js/yahoo-dom-event.js"></script> <script type="text/javascript" src="js/modencode.js"> </script> </head> <body vlink='black' link='black' onload=setActiveLink('Introduction')> <table width="100%"> <tr valign=top> <td> <a href="http://www.modencode.org/"> <img src="/img/modENCODE_logo_small.png" border=0 alt="modENCODE home"/></a> <div class=Links> <h4>RESOURCES</h4> <a class=list id=PublicFTP href="ftp://ftp.modencode.org/pub/">Public Data</a><br> <a class=list id=GenomesLink href="/Genomes.shtml" >Browse Genomes</a><br> <a class=list id=Mine href="http://intermine.modencode.org/query/">modMine</a><br> <a class=list id=VoteLink href="/Vote.shtml" >TF Priority List</a><br> <a class=list id=ProtocolsLink href="/Protocols.shtml" >Protocols</a><br> <a class=list id=ReagentsLink href="/Reagents.shtml" >Reagents</a><br> <a class=list id=WIKILink href="http://wiki.modencode.org/project/">WIKI</a> <span class=PI>[login]</span><br> <a class=list id=SteinLink href="/Stein.shtml" >Data Coordinating Center</a><br> <a class=list id=Policy href="/docs/modENCODE_publication_policy.pdf">Publication Policy</a><br>  <a class=list id=Pipeline href="http://submit.modencode.org/submit/" >Data Submission</a><span class=PI>[login]</span><br> <a class=list id=ContactLink href="mailto:help@modencode.org" >Contact us</a><br> <a class=list id=IntroductionLink href="/index.shtml" >Home</a> </div> <div class=Links> <h4><span>PROJECTS</span></h4> <span class=list><i>C. elegans</i></span><br> <a class=list id=WaterstonLink href="/Waterston.shtml" >The Transcriptome</a><br> <a class=list id=LiebLink href="/Lieb.shtml" >Chromatin Function</a><br> <a class=list id=HenikoffLink href="/Henikoff.shtml" >Histone Variants</a><br> <a class=list id=SnyderLink href="/Snyder.shtml" >Regulatory Elements</a><br> <a class=list id=PianoLink href="/Piano.shtml" >The 3' UTRome</a> <br> <span class=list><i>D. melanogaster</i></span><br> <a class=list id=CelnikerLink href="/Celniker.shtml" >The Transcriptome</a><br> <a class=list id=WhiteLink href="/White.shtml" >Regulatory Elements</a><br> <a class=list id=KarpenLink href="/Karpen.shtml" >Chromosomal Proteins</a><br> <a class=list id=LaiLink href="/Lai.shtml" >Small and microRNAs</a><br> <a class=list id=MacAlpineLink href="/MacAlpine.shtml" > Origins of Replication</a> </div> <div class=Links> <h4>EXTERNAL LINKS</h4>  <a class=list href="http://www.genome.gov/modencode/" >modENCODE@NHGRI</a> <br> <a class=list href="http://www.flybase.org">FlyBase</a><br> <a class=list href="http://www.wormbase.org">WormBase</a><br>  <a class=list href="http://www.flymine.org/" >FlyMine</a><br> </div> </td> <td align=left> <table width="96%" align=center cellpadding=5 cellspacing=0> <tr> <td colspan=4> <tr > <td valign=center align=right bgcolor=#5f5050 width=10% > <font color=white size=2 face=helvetica> <b>Browse Genomes:</h4> <td valign=center align=left bgcolor=#5f5050 width=35%>  <a href="http://modencode.oicr.on.ca/cgi-bin/gbrowse/worm" target="_blank"> <img src="/img/wgb_s.png" alt="C.elegans"/></a>  <a href="http://modencode.oicr.on.ca/cgi-bin/gbrowse/fly" target="_blank"> <img src="/img/dgb_s.png" alt="D.melanogaster"/></a> <td valign=center align=right bgcolor=#ad8d8c width=10%> <font color=white size=2 face=helvetica> <b>mine modENCODE: <td bgcolor=#ad8d8c width=15%> <a href="http://intermine.modencode.org/query/"> <img src="/img/modmine_s.png" alt="query!!"/></a> </td></tr> </table> <div id="main">  <h2>Locus-specific qPCR</h2> <p> Locus specific PCR amplification </p> <ul> <li>For qPCRs use 2 ul of the <a href="./ip.shtml">IP</a>s and 2 ul of 1:400 dilution of the inputs. If using <a href="./lm-pcr.shtml">LM-PCR</a> amplified material, then take 1 ul of the amplified samples and dilute 1:50. Use 2 ul of that.</li> <li>For qPCR directly from IP material set up 50 ul ChIP reaction and use following amplification: </li> </ul> <p> <code><pre> Step 1: 95° C for 5 min Step 2: 95°C for 30 sec Step 3: 58°C for 30 sec Step 4: 72°C for 1 min Go to step 2 for 11 times Step 5: 95°C for 30 sec Step 6: 55°C for 30 sec Step 7: 72°C for 1 min Go to step 5 for 17 times Step 8: 72° C for 5 min Step 9: 4° C </pre></code> Take 20 ul of the sample and check amplification on a 1.8%gel. Keep 30 ul on ice while gel is running. If amplification is not enough do a couple more cycles of PCR with the rest. </p> <ul> <li>For PCR from 1:50 diluted amplified samples use the following amplification parameters: </li> </ul> <p> 22 cycles 2 step PCR with 58 (12 cycles) and 55 C (10 cycles) annealing temperature. Example gel </p> <p> <img src="./images/LS-PCRex.jpg" width="200" alt="LS-PCRex.jpg" /> </p> <p> 1-6 samples: 1: SDC-3 IP, 2: SDC-3 input, 3: DPY-27 IP, 4: DPY-27 Input, 5: NoAntibody IP, 6: No antibody Input. </p> <ul> <li>Top band: sample </li> <li>Bottom: control </li> </ul> <table border="1"> <tr> <td>+Control primers </td> </tr> <tr> <td>Act1F2 </td> <td>GTGATCTTACTGATTACCTC </td> </tr> <tr> <td>Act1R </td> <td>TGTCCGTCAGGAAGTTCGTA </td> </tr> <tr> </tr> </table> <table border="1"> <tr> <td>+Sample primers </td> </tr> <tr> <td>R160_middle_F </td> <td>GCATCAACAAGCCGCAATGC </td> </tr> <tr> <td>R160_middle_R </td> <td>TTGCTTGTACGCACATATAC </td> </tr> </table> </div> </td> </tr> </table> <script type="text/javascript"> var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www."); document.write(unescape("%3Cscript src='" + gaJsHost + "google-analytics.com/ga.js' type='text/javascript'%3E%3C/script%3E")); </script> <script type="text/javascript"> var pageTracker = _gat._getTracker("UA-4121742-1"); pageTracker._initData(); pageTracker._trackPageview(); </script> </body> </html>