This is an extensive tutorial to take you through the main features and gotchas of configuring GBrowse as a server. This tutorial assumes that you have successfully setup Perl, GD, BioPerl and the other GBrowse dependencies. During most of the tutorial, we will be using the "in-memory" GBrowse database (no relational database required!) Later we will show how to set up a genome size database using the berkeleydb and MySQL adaptors.
Important:This tutorial is designed for GBrowse 1.69, which is expected to be released in late May. This version is currently available from CVS. It uses GFF3 format files (.gff3), not the GFF version 2 (.gff) files used by version 1.68 and earlier. For a tutorial that uses the older Bio::DB::GFF adaptor, see Using GBrowse with Bio::DB::GFF.
We will be working with simulated Volvox genome annotation data. The database will be named "volvox" and GBrowse will be invoked with this URL:
http://localhost/cgi-bin/gbrowse/volvox
These directories contain data files used during the tutorial:
To introduce you to the system we will be using a file-based database which allows GBrowse to run directly off text files. To prepare this database for use, find the GBrowse databases directory which was created in your Apache web server directory at the time of installation. It should be located at /FRONT-END/www/html/gbrowse/databases, but check to make sure.
Similarly, check that you can find the gbrowse.conf configuration directory. It should be located at /FRONT-END/www/conf/gbrowse.conf and contain the configuration file "yeast.conf."
Now you will change the permissions of the database and configuration directories so that you can write to them without root privileges. This is only an issue on Unix systems, and Windows users can safely ignore this step.
% su Password: ********* # chown my_user_name /FRONT-END/www/html/gbrowse/databases # chown my_user_name /FRONT-END/www/conf/gbrowse.conf # exit %
(Be sure to replace "my_user_name" with your login name!)
Now look around inside the databases directory. There should be a single subdirectory named "yeast_chr1+2". The yeast subdirectory is where the example yeast chromosomes 1 and 2 data set is stored.
You will create an empty volvox subdirectory, and make it world writable. On Unix systems:
% cd /FRONT-END/www/html/gbrowse/databases % mkdir volvox % chmod go+rwx volvox
NOTE: The "%" sign in these examples is the command-line prompt. On Windows systems, the command-line prompt is something like C:\Program Files\Apache Group\Apache2\htdocs\gbrowse\databases>. Unix systems are more variable, but the prompt usually ends with a "%" or a "#". In all the examples in this tutorial, what you type is rendered in boldface, while prompts and command-line results are shown in medium typeface.
On Windows systems, use the file manager ("Explorer") to create a new folder named "volvox." If you are using Windows NT, 2000 or XP, right click on the new folder and grant write privileges to all.
You'll now put the first of several data files into the volvox database directory. In the data_files subdirectory of this tutorial you will find the file volvox1.gff3. Copy this into the volvox database directory. On Unix systems:
% cd /FRONT-END/www/html/gbrowse % cp tutorial/data_files/volvox1.gff3 databases/volvox
On Windows systems, use Explorer to copy the file into the volvox database directory.
Now we will need a GBrowse config file to tell GBrowse how to render this data set. In the subdirectory conf_files, you will find a sample configuration file named volvox.conf. Copy this into your GBrowse configuration directory (/FRONT-END/www/conf/gbrowse.conf).
You should now be able to view the data set. Point your web browser at http://localhost/cgi-bin/gbrowse/volvox and type in "ctgA" in the search box. The result is shown in Figure 1.
Figure 1: volvox1.gff3 data with volvox.conf config file.
If for some reason you get a blank page or an "Internal server error," there are a couple of things to check. First, open the file volvox.conf with a text editor ("Notepad" on Windows systems, emacs, pico or vi on Unix systems) and confirm that the path to the volvox database directory in this section is correct:
db_adaptor = Bio::DB::SeqFeature::Store db_args = -adaptor memory -dir '/FRONT-END/www/html/gbrowse/databases/volvox'
If there is a space in "/FRONT-END/www/html" then you must be certain to put single quotes around the path as shown in the example above.
Next check that the volvox1.gff3 file does exist inside the volvox database directory and that it is readable by all users on your system. Similarly, check that the volvox.conf configuration file is in the same directory as yeast.conf, and that it is readable by all users on your system.
Microsoft Windows has an unpleasant tendency to add a ".txt" extension to files without warning. If something seems to be wrong with the config or GFF file and you can't figure out what, check that the file extension hasn't been modified. To avoid this phenomenon, I suggest that you select "All File Types" from the popup menu in the File Save dialog. You might also want to configure your Folder display to show known file extensions.
If you're still having no luck, check the bottom of the Apache server error log for error messages. This file is located in various places depending on how Apache is installed. Look for the file error_log, typically located in /usr/local/apache/logs, C:\Program Files\Apache Group\Apache2\logs, /var/log/www, or /var/log/httpd. The error message will usually point you in the right direction.
If this doesn't fix the problem, please stop the tutorial and send an e-mail to GBrowse support at gmod-gbrowse@lists.sourceforge.net. Someone will be happy to assist you.
Let's look at the data file we loaded in detail now. If you open the volvox1.gff3 file in a text editor, you will see that it contains a series of 15 genome "features" that look like this:
ctgA example contig 1 50000 . . . Name=ctgA ctgA example remark 1659 1984 . + . Name=f07;Note=This is an example ctgA example remark 3014 6130 . + . Name=f06;Note=This is another example ctgA example remark 4715 5968 . - . Name=f05;Note=Ok! Ok! I get the message. ctgA example remark 13280 16394 . + . Name=f08 ...
Each feature has a "source" of "example", a type of "remark", and occupies a short range (roughly 1.5k) on a contig named "ctgA." In addition to the features themselves, there is an entry for the contig itself (type "contig"). This entry is needed to tell GBrowse what the length of ctgA is.
The load file uses a standard known as GFF3 (General Feature Format version 3). Each line of the file corresponds to a feature on the genome, and the nine columns are separated by tabs.
The 9 columns are as follows:
Alias=M19211,gna-12,GAMMA-GLOBULINOther good stuff can go into the attributes field, as we shall see later.
It is very important to have a full-length entry (such as the one for ctgA) for each reference sequence mentioned in the first column of the GFF3 file. However, the reference sequence can have any source and type you choose. Commonly used types are "clone", "chromosome" and "contig."
Now we'll look at the configuration file in more detail. Using a text editor, open the volvox.conf file from its location in the gbrowse.conf configuraton directory. (If you mess up, you can always copy a fresh version from volvox.conf in the tutorial directory).
Ignore all the stuff in the top 90% of the file, and focus on the last
little bit, which starts with the line: ### TRACK CONFIGURATION
###:
[ExampleFeatures] feature = remark glyph = generic stranded = 1 bgcolor = blue height = 10 key = Example Features
This is a "stanza" that describes one of the tracks displayed by GBrowse. The track has an internal name of "ExampleFeatures" which you can use in the URL to turn the track on. The internal name is enclosed by square brackets. Names can be any combination of printable characters and whitespace, but can not contain the hyphen ("-") character (you can use the underscore "_" character instead).
Following the track name are a series of options that configure the track. The "feature" option indicates what feature type(s) to display inside the track. It's currently set to display the "remark" feature type. The "glyph" option specifies the shape of the rendered feature. The default is "generic", which is a simple filled box, but there are dozens of glyphs to choose from. The "stranded" option tells the generic glyph to try to display the strandedness of the feature -- this is what creates the little arrow at the end of the box. "bgcolor" and "height" control the background color and height of the glyph respectively, and "key" assigns the track a human-readable label.
Let's experiment with changing the track definition. First, let's change the color of the glyph. With your text editor, change the bgcolor option from blue to "orange", save it, and reload the page. The features should change immediately as shown in Figure 2
Figure 2: A Feature of a Different Color
Note: Many of the screenshots in this tutorial are from earlier versions of GBrowse and may not look exactly the same as the current version.
Please experiment with other changes! Try changing the height to 5, the key to "Skinny features" and the stranded option to 0 (which means "false"). Just by changing a few options, you can create a very distinctive track.
Now let's try changing the glyph. One of the standard glyphs was designed to show PCR primer pairs and is called "primers". Change "glyph = generic" to "glyph = primers" and reload the page. Depending on other changes that you might have made earlier, the result will look something like Figure 3.
Figure 3: Using the primers Glyph
We'll see other examples of glyphs later on. To get a list of the most popular glyphs and the options that are available for them, see the file CONFIGURE_HOWTO.txt, located in the docs/ subdirectory of the GBrowse distribution. Or for the gory and bleeding edge details, run the command:
% perldoc Bio::Graphics::Panel
This produces copious documentation on the Perl interface to all the glyphs, including some amazingly obscure ones, from which you should be able to deduce the GBrowse equivalents.
By default, GBrowse will display the name of the feature above its glyph provided that there is sufficient space to do this. Optionally, you can also attach some descriptive text to the feature. This text will be displayed below the feature, and can also be searched.
You can place descriptions, notes and other comments into the ninth column of the GFF load file. The example file volvox2.gff3 shows how this is done. An excerpt from the top of the file looks like this:
ctgA example polypeptide_domain 11911 15561 . + . Name=m11;Note=kinase ctgA example polypeptide_domain 13801 14007 . - . Name=m05;Note=helix loop helix ctgA example polypeptide_domain 14731 17239 . - . Name=m14;Note=kinase ctgA example polypeptide_domain 15396 16159 . + . Name=m03;Note=zinc finger
This defines several new features of type "polypeptide_domain". The ninth column, in addition to giving each of the motifs names adds a "Note" attribute to each feature. As described earlier, each attribute is a name=value pair separated by semicolons.
The attribute named Note is automatically displayed and made searchable. To see this work, add volvox2.gff3 to the volvox database. You can do this just by copying the file into /FRONT-END/www/html/gbrowse/databases/volvox so that the directory contains both the original volvox1.gff3 and the new volvox2.gff3 files.
To display this newly-loaded data set, open up volvox.conf and add the following new stanza to the config file:
[Motifs] feature = polypeptide_domain glyph = span height = 5 description = 1 key = Example motifs
This defines a new track whose internal name is "Motifs." The corresponding feature type is "motif" and it uses the "span" glyph, a graphic that displays a horizontal line capped by vertical endpoints. The height is set to five pixels, and the human-readable key is set to "Example motifs." A new option, "description" is a flag that tells GBrowse to display the Note attribute, if any. Any non-zero value means true.
After updating the configuration file, you will need to reload the browser page and turn on the "Example motifs" checkbox below the main image. The result is shown in Figure 4.
Figure 4: Showing the Notes attribute
A copy of this config file is also available for you to use in volvox2.conf.
To show that GBrowse will search the notes for keyword matches, try typing in "kinase." You will be presented with a list of all the motifs whose Note attribute contains the word "kinase."
GBrowse has a very flexible search feature. You can type in the name of a reference sequence, such as "ctgA", and it will display the entire thing, or you can type in a range in the format "ctgA:start..stop". Try "ctgA:5000..8000" to see this at work.
In addition, GBrowse can search for features by name. Anything that has a Name or Alias attribute in the GFF3 file can be searched for by name. For example, try searching for "f10" or even "f1*". The only drawback to this is that you may have name collisions. For example, some research communities distinguish genes from their products using differences in capitalization, for example hga and HGA. However, GBrowse's searches are case insensitive. To avoid name collisions, you can give each type of feature a distinctive naming prefix, for example "Gene:hga" and "Protein:HGB".
To illustrate how this works, have a look at volvox2b.gff3:
ctgA example remark 1000 2000 . . . Name=hga ctgA example protein_coding_primary_transcript 1100 2000 . + . Name=Gene:hga ctgA example polypeptide 1200 1900 . + . Name=Protein:HGA ctgA example protein_coding_primary_transcript 1600 3000 . - . Name=Gene:hgb ctgA example polypeptide 1800 2900 . - . Name=Protein:HGB
Copy this file into the databases/volvox folder. Note that as you add new files to the database folder, you may need to disable caching in to see the new features show up immediately. To do this, simply scroll down to the "Display Settings" portion of the GBrowse display and unselect "Cache tracks."
Now add the following configuration stanza to volvox.conf to create a track that displays both protein_coding_primary_transcript and polypeptide features:
[NameTest] feature = protein_coding_primary_transcript polypeptide glyph = generic stranded = 1 bgcolor = green height = 10 key = Name test track
This stanza creates a new track named "Name test track" and displays features of type "protein_coding_primary_transcript" and "polypeptide" using green generic glyphs that are 10 pixels high. When you look at the data file, you'll see that there are three things potentially named "HGA", a remark which uses the unqualified name, a gene which uses the qualified name "Gene:hga", and a polypeptide region which uses the qualified name "Protein:HGA." There is also a protein_coding_primary_transcript named "Gene:hgb" and a protein named "Protein:HGB." (Note, in this track we are using slightly awkward sequence ontology terms, like "protein_coding_primary_transcript," rather than more natural terms like "gene" in order to avoid these example features from appearing in the real "gene" track that we create later on in this tutorial.)
To see how GBrowse searches for names, type "HGA" (either upper or lowercase) in the search textbox and press "Search." Because the search term matches the remark whose unqualified name is HGA, GBrowse will bring up the region between 1000..2000 and highlight the HGA remark.
Now search for "Protein:HGA." Because you searched with the qualified name, GBrowse will find and highlight the protein feature.
Now try to search for "HGB." This search fails because HGB only exists in qualified form in the database. You can still, however, search for "Gene:HGB" or "Protein:Hgb" (capitalization doesn't matter). This may or may not be the behavior that you desire. If you would like GBrowse to search through qualified names when the user types the unqualified version, you can configure this easily by adding the following line to volvox.conf under the [General] section:
automatic classes = Gene Protein
This option directs GBrowse to search for the unqualified name first, followed by names prefixed with "Gene:" and then names prefixed with "Protein:". Whichever is found first will be displayed. Now searching for "HGB" will find "Gene:hgb". Swapping the order of Gene and Protein on this line will cause the "Protein:HGB" to be found.
Another way to approach this is to make liberal use of the Alias attribute. For example:
ctgA example remark 1000 2000 . . . Name=Remark:HGA;Alias=hga ctgA example protein_coding_primary_transcript 1100 2000 . + . Name=Gene:hga;Alias=hga ctgA example polypeptide 1200 1900 . + . Name=Protein:HGA;Alias=hga ctgA example protein_coding_primary_transcript 1600 3000 . - . Name=Gene:hgb;Alias=hga ctgA example polypeptide 1800 2900 . - . Name=Protein:HGB;Alias=hga
This assigns the alias of "hga" to each of the three HGA features, and an alias of "hgb" to each of the two HGB features. This keeps the identities of these features distinct so that you can find particular ones by typing in the fully qualified name ("Gene:hga"), but find all candidates when you type in the unqualified name. For instance, when you search with "hga", GBrowse will now offer you three matches:
Figure 5: Searching for aliases
The next topic we'll cover in this tutorial is configuring GBrowse's
outgoing links. When the user clicks on a glyph in the details image,
he will be taken to another page by following a URL. The URL to
follow is generated from the link option. The default
link option is located in the [TRACK DEFAULTS] section of the config
file; you can specify track-specific links by placing a
link option in one or more of the individual track
stanzas.
The volvox.conf track defaults looks like this:
[TRACK DEFAULTS] glyph = generic height = 10 bgcolor = lightgrey fgcolor = black font2color = blue label density = 25 bump density = 100 # where to link to when user clicks in detailed view link = AUTO
In this case, we've been using a special link URL of "AUTO." This generates an automatic link to a helper script named "gbrowse_details." If you click on some of the features in the current volvox page you'll get an idea of what this script displays.
We're going to override the default link rule for the motif track. There's nothing sensible to link to, so we'll link to Google using first the motif's name, and then the motif's description.
Go to the [Motifs] stanza in the volvox.conf config file and modify it so that it looks like this:
[Motifs] feature = polypeptide_domain glyph = span height = 5 description = 1 link = http://www.google.com/search?q=$name key = Example motifs
The only change we've made is to add a "link" option to the stanza, where the value is a Google search URL. "$name" is a Perl variable. GBrowse will fill in this variable with the name of the motif. Reload the page and click on a motif to see that this works as advertised ("m01," "m02" and the other example motifs are similar to the names for galactic clusters, so be prepared for some astronomy hits).
It would be more sensible to link to the description of the motif, for example "helix loop helix." Fortunately we can do that too. Just change the link option to:
link = http://www.google.com/search?q=$description
There are a large number of possible variables that you can use inside link rules. See the CONFIGURE_HOWTO document in the GBrowse distribution for the full list. You can also construct links using Perl callbacks as described in the section on displaying ESTs. This gives you the ability to generate any arbitrary URL.
If you want nothing to happen when the user clicks on a feature, just set link to empty ("link = ").
The last thing we'll do is to change the behavior of the [Motif] track so that:
These changes are easy:
[Motifs] feature = polypeptide_domain glyph = span height = 5 description = 1 link = http://www.google.com/search?q=$description link_target = _blank title = Search Google for $description. key = Example motifs
There's now a link_target option. This contains the name
of a browser window in which to load the content when the user clicks
on the feature. If there's no window of that name, the browser will
create a new window and give it the desired name. Choose an ordinary
name like "Google" if you want the Google content to be loaded into
the same window each time, or choose "_blank" as we've done here in
order to pop up a new fresh window each time the user clicks.
The title option contains a bit of text that will be
displayed whenever the user hovers the mouse over the feature for a
second or two. The same variable substitution rules apply, so when
the user mouses over feature "m06", a hints window will pop up that
says "Search Google for SUSHI repeat." Give it a try!
GBrowse can display popup balloons when the user hovers over or clicks on a feature. The balloons can display arbitrary HTML, either provided in the config file, or fetched remotely via a URL. You can use this feature to create multiple choice menus when the user clicks on the feature, to pop up images on mouse hovers, or even to create little embedded query forms. See http://mckay.cshl.edu/balloons.html for examples.
In the config file for the database you wish to modify, set ``balloon tips'' to a true value:
[GENERAL]
...
balloon tips = 1
Then add ``balloon hover'' and/or ``balloon click'' options to the track stanzas that you wish to add buttons to. You can also place these options in [TRACK DEFAULTS] to create a default balloon.
``balloon hover'' specifies HTML or a URL that will be displayed when the user hovers over a feature. ``balloon click'' specifies HTML or a URL that will appear when the user clicks on a feature. The HTML can contain images, formatted text, and even controls. Examples:
balloon hover = <h2>Gene $name</h2>
balloon click = <h2>Gene $name</h2>
<a href='http://www.google.com/search?q=$name'>Search Google</a><br>
<a href='http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&term=$name'>Search NCBI</a><br>
For example, to add a balloon to the motifs track of the Volvox browser, add "balloon tips = 1" near the top of the volvox.conf file, and then add balloon hover and balloon click options like this:
[Motifs]
feature = polypeptide_domain
glyph = span
height = 5
description = 1
balloon hover = <h2>Gene $name</h2>
balloon click = <h2>Gene $name</h2>
<a href='http://www.google.com/search?q=$name'>Search Google</a><br>
<a href='http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&term=$name'>Search NCBI</a><br>
key = Example motifs
Alternatively, you can populate the balloon using data from an HTML page or dynamic CGI script running on the same server as GBrowse. This uses AJAX; it can often speed up page loading by reducing the amount of text that must be downloaded by the client. To dynamically load the balloon contents from the server, use a balloon hover or balloon click option like this:
balloon click = /cgi-bin/get_gene_data?gene=$name
In this case, when the user clicks on the feature, it creates a balloon whose content contains the HTML returned by the CGI script ``get_gene_data''. GBrowse knows that this is a URL rather than the contents of the balloon by looking for the leading slash. However, to reduce ambiguity, we recommend that you prefix the URL with ``url:'' as so:
balloon click = url:/cgi-bin/get_gene_data?gene=$name
This also allows you to refer to relative URLs:
balloon click = url:../../get_gene_data?gene=$name
It is also possible to fill the balloon with content from a remote source. Simply specify a full URL beginning with ``http:'' ``https:'' or ``ftp:''
balloon hover = http://www.wormbase.org/db/get?name=$name;class=gene
Note that the balloon library uses an internal <iframe> to populate the balloon with the content of external URLs. This means that vertical and horizontal scrollbars will appear if the content is too large to be contained within the balloon. If the formatting does not look right, you can design a custom balloon of the proper size as described in the next section.
The usual option value substitution rules ($name, $start, etc) work with balloons, as do callbacks. GBrowse will automatically escapes single (') and double (``) quotes in the values returned by the ''balloon hover`` and ''balloon click`` options so that you don't have to worry about them messing up the HTML.
You might also wish to specify ``titles are balloons'' in the [GENERAL] section:
[GENERAL] titles are balloons = 1
This will generate balloons on all mouse hover events, using the content that would otherwise have been placed in the built-in browser tooltip.
There is a limited amount of balloon customization that you can perform within each [track] section. If you wish the balloon to be sticky (require the user to press the close button) even if it is a hover balloon, then place this option in the [track section]:
balloon sticky = 1
Setting ``balloon sticky'' to 0 will have the effect of making balloons disappear as soon as the mouse leaves them, even if it was created by a mouse click event.
If you are displaying content from a remote web or FTP server and you do not like the height of the balloon, you can adjust the height with the ``balloon height'' option:
balloon height = 400
GBrowse supports multiple balloons with different shapes, sizes, background images and timing properties. There is one built-in balloon, named "balloon", which should meet most peoples' needs. However, you can configure any number of custom balloons.
To declare two new balloons, create a "custom balloons" option in the [GENERAL] section:
custom balloons = [blue_balloon]
images = /gbrowse/images/blue_balloons
maxWidth = 300
shadow = 0
[wide_balloon]
maxWidth = 800
This creates two new balloons. The first, named "blue_balloon" will look for its images and icons at the local URL /gbrowse/images/blue_balloons. It will have a maximum width of 300 pixels, and will cast no shadow. The second, named "wide_balloon" takes all the defaults for the default balloon, including the location of its images in the directory /gbrowse/images/balloons, except that it has a maximum width of 800 pixels. The various balloon options are described in the GMOD wiki.
To use the blue balloon rather than the standard one, format the "balloon hover" and/or "balloon click" options like this:
balloon click = [blue_balloon] /cgi-bin/get_gene_data?gene=$name
The [blue_balloon] keyword tells gbrowse to use the blue balloon for clicks on these features. The standard balloon is called "balloon", and so the following two options are equivalent:
balloon click = /cgi-bin/get_gene_data?gene=$name balloon click = [balloon] /cgi-bin/get_gene_data?gene=$name
The images for custom balloons reside in the default location of /gbrowse/images/balloons, unless indicated otherwise using the ``images'' config option. To use custom balloon images, point "images" to a a web-accessible directory in your document tree which contains the seven PNG images described in the documentation.
These images must be named as listed below:
balloon.png down_right.png up_right.png balloon_ie.png down_left.png up_left.png close.png
Tips for creating these images can be found here.
Now that you've seen the basics, we'll discuss techniques to display multi-part features, genes, alignments, quantitative data and other special feature types.
Many features are discontinuous. Examples include spliced transcripts, and gapped sequence similarity alignments, such as the alignment of cDNAs to the genome. GBrowse can deal with such features easily provided that you take a little care in setting them up.
The data file volvox3.gff3 contains a simulated data set of a series of gapped nucleotide alignments. An excerpt from the file is here:
ctgA example match 32329 32359 . + . ID=match-seg01;Name=seg01 ctgA example match 26122 26126 . + . ID=match-seg02;Name=seg02 ctgA example match 26497 26869 . + . ID=match-seg02;Name=seg02 ctgA example match 27201 27325 . + . ID=match-seg02;Name=seg02 ctgA example match 27372 27433 . + . ID=match-seg02;Name=seg02 ctgA example match 27565 27565 . + . ID=match-seg02;Name=seg02 ctgA example match 27813 28091 . + . ID=match-seg02;Name=seg02 ctgA example match 28093 28201 . + . ID=match-seg02;Name=seg02 ctgA example match 28329 28377 . + . ID=match-seg02;Name=seg02 ctgA example match 28829 29194 . + . ID=match-seg02;Name=seg02 ctgA example match 6885 7241 . - . ID=match-seg03;Name=seg03 ctgA example match 7410 7737 . - . ID=match-seg03;Name=seg03 ctgA example match 8055 8080 . - . ID=match-seg03;Name=seg03 ctgA example match 8306 8999 . - . ID=match-seg03;Name=seg03
This file uses a new GFF3 attribute, "ID". The ID attribute is used to group features together and to indicate when a single feature occupies multiple discontinuous locations. In the case of a gapped alignment, each ungapped segment is represented by a single GFF3 line. The segments of a single alignment are then grouped together by using the same ID. For example "match-seg03" starts at position 6885 and ends at 8999. It has four subsegments, one from 6885..7241, another from 7410..7737, and so forth.
The ID attribute is not the same as the Name attribute. If you give three lines the same ID, they will be grouped together into a single displayed feature. If you give three lines the same Name you will end up with three distinct features that all happen to share the same name. Also note that except for the coordinates and the score (which we'll discuss later) all columns for each of the parts of a multisegmented feature should be the same. For example, you can't have one part of a feature on the (+) strand and another part on the (-) strand.
Copy volvox3.gff into the volvox database directory. Then edit volvox.conf to add the following track definition:
[Alignments] feature = match glyph = segments key = Example alignments
This is declaring a new track named "Alignments" which displays features of type "match" using a glyph named "segments". The segments glyph is specialized for displaying objects that have multiple similar subparts. Reload the page and activate the "Example alignments" track. You should see a track similar to Figure 6.
![]()
Figure 6: Use the "segments" glyph to display discontinuous multipart features.
GBrowse can display protein-coding genes in various shapes and styles. The easiest way to set this up is to use the sequence ontology's canonical description of a gene along with the "gene" glyph. Take a look at the file volvox4.gff3, which defines a gene named EDEN, and its three spliced forms named EDEN.1, EDEN.2 and EDEN.3. Here is the contents of the file:
ctgA example gene 1050 9000 . + . ID=EDEN;Name=EDEN;Note=protein kinase ctgA example mRNA 1050 9000 . + . ID=EDEN.1;Parent=EDEN;Name=EDEN.1;Index=1 ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.1 ctgA example CDS 1201 1500 . + 0 Parent=EDEN.1 ctgA example CDS 3000 3902 . + 0 Parent=EDEN.1 ctgA example CDS 5000 5500 . + 0 Parent=EDEN.1 ctgA example CDS 7000 7608 . + 0 Parent=EDEN.1 ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.1 ctgA example mRNA 1050 9000 . + . ID=EDEN.2;Parent=EDEN;Name=EDEN.2;Index=1 ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.2 ctgA example CDS 1201 1500 . + 0 Parent=EDEN.2 ctgA example CDS 5000 5500 . + 0 Parent=EDEN.2 ctgA example CDS 7000 7608 . + 0 Parent=EDEN.2 ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.2 ctgA example mRNA 1300 9000 . + . ID=EDEN.3;Parent=EDEN;Name=EDEN.3;Index=1 ctgA example five_prime_UTR 1300 1500 . + . Parent=EDEN.3 ctgA example five_prime_UTR 3000 3300 . + . Parent=EDEN.3 ctgA example CDS 3301 3902 . + 0 Parent=EDEN.3 ctgA example CDS 5000 5500 . + 1 Parent=EDEN.3 ctgA example CDS 7000 7600 . + 1 Parent=EDEN.3 ctgA example three_prime_UTR 7601 9000 . + . Parent=EDEN.3
GFF3 uses a three-tiered structure to represent the gene, descending from gene to mRNA to CDS and UTR features. A gene has potentially many mRNAs, and each mRNA has potentially several CDS and UTR features. To describe how the parts fit together, we use ID and Parent features.
We start with a feature of type "gene" with the ID "EDEN". This has three alternative splice forms named EDEN.1, EDEN.2 and EDEN.3. To tell GBrowse that each of these splice forms are part of the same gene, we give each one a Parent attribute of "EDEN" corresponding to the ID of the parent gene. Now consider mRNA EDEN.1. It has a five_prime_UTR feature, a three_prime_UTR feature, and four CDS features. To indicate that the CDS and UTR features belong to the mRNA, we give the mRNA a unique ID of "EDEN.1" and give each of the subfeatures a corresponding parent. This pattern repeats for each of the other two splice forms. Note how the five_prime_UTR of EDEN.3 is split in two parts.
As before, we use "Name" to give the gene and its alternative splice forms a human-readable name, and use Note to provide a description for the gene as a whole (you can add notes to the individual mRNAs but they won't display by default). The Index=1 attribute is a hint to the database to make the mRNAs searchable by name. This lets users find the gene by searching for the mRNA names ("EDEN.1") as well as by the gene name ("EDEN"). However, it is usually unecessary to do this. Also notice that we are using the Phase column for the CDS features to describe how the CDS is translated into protein. See the description of phase in the data file section.
This is the full way to describe genes. Simpler ways are described later in this section.
HINT: If you prefer not to distinguish between 5' and 3' UTRs, you can simply use "UTR" as the type. If you don't know where the UTRs are, just leave them blank. If you'd rather think in terms of exons and introns, then check out so_transcript glyph.
Go ahead and add volvox4.gff3 to the database. Then add the following new stanza to the bottom of the file:
[Genes] feature = gene glyph = gene bgcolor = peachpuff label_transcripts = 1 draw_translation = 1 category = Genes key = Protein-coding genes
The new Genes track associates "gene" features with the "gene" glyph, sets its background color to peachpuff (yes, there really is a color by this name!), turns on the description lines, and sets the human readable track name to "Protein-coding genes."
Upon reloading the page, turning on the new "Protein-coding genes" track, and viewing the region around 1..10K, you'll see this:
Figure 7: The canonical gene
The gene glyph has a number of options that you can use to customize its appearance:
| Option Name | Possible values | Description |
|---|---|---|
| thin_utr | 0 (false), 1 (true) | If true, makes UTRs half-height. |
| utr_color | a color name ("gray" by default) | Changes the UTR color. |
| decorate_introns | 0 (false), 1 (true) | If true, puts little arrowheads on the introns to indicate direction of transcription. |
Using these options, we can make the track look like the UCSC Genome Browser (Figure 8).
[Genes] feature = gene glyph = gene height = 8 bgcolor = black utr_color = black thin_utr = 1 decorate_introns = 1 description = 1 key = Protein-coding genes
Figure 8: A UCSC Genome Browser lookalike
If the full three-tiered representation of a gene bugs you, there are simpler alternatives. To represent a typical predicted gene that only has a translated region, you can represent the translation as a single CDS line for a single-exon gene, or a series of linked lines for a spliced gene. data_files/volvox4b.gff3 shows how to do this:
ctgA predicted CDS 10000 11500 . + 0 Name=Apple1 ctgA predicted CDS 13000 13800 . + 0 ID=cds-Apple2;Name=Apple2 ctgA predicted CDS 15000 15500 . + 1 ID=cds-Apple2;Name=Apple2 ctgA predicted CDS 17000 17200 . + 2 ID=cds-Apple2;Name=Apple2
This creates two linked CDS sets: a single exon predicted called Apple1 and a three-exon gene called Apple2. Note that we use a common ID to tie the three Apple2 exons together.
The corresponding stanza will look like this:
[CDS] feature = CDS:predicted glyph = gene bgcolor = white category = Genes key = Predicted genes
We are still using the gene glyph. However, be aware that this depends on a recent (as of January 2008) enhancement to bioperl-live. If the gene does not display properly for you, then either install a newer version of bioperl (for example, the SVN "bioperl-live" version), or use the older "transcript" glyph instead of the gene glyph.
The other thing to notice is that the feature is now qualified as "CDS:predicted". This corresponds to a GFF3 type (column 3) of "CDS", and a GFF3 source (column 2) of "predicted." In all previous examples, we used an unqualified feature name, but in this case we don't want the CDS subfeatures from the three-tier EDEN gene examples to be displayed in the predicted gene track. Therefore we limit the features that are displayed in this track by qualifying the feature type with its source using the syntax shown here.
The result is shown in Figure 9:
Figure 9: Simpler genes using linked CDSs and the transcript glyph
The bottom six lines of volvox4b.gff3 show how to display a single transcript that has both coding and non-coding regions.
ctgA exonerate mRNA 17400 23000 . + . ID=rna-Apple3;Name=Apple3;Note=Predicted ctgA exonerate UTR 17400 17999 . + . Parent=rna-Apple3 ctgA exonerate CDS 18000 18800 . + 0 Parent=rna-Apple3 ctgA exonerate CDS 19000 19500 . + 1 Parent=rna-Apple3 ctgA exonerate CDS 21000 21200 . + 2 Parent=rna-Apple3 ctgA exonerate UTR 21201 23000 . + . Parent=rna-Apple3
To represent this transcript, we need to create a feature of type mRNA and a unique ID, followed by several UTR and CDS subfeatures all linked to the mRNA via their Parent attribute. In this example we use "UTR" for the UTR features, although the more explicit "five_prime_UTR" and "three_prime_UTR" types will also work. The "so_transcript" (Sequence Ontology transcript) glyph knows how to display these correctly:
[Transcript] feature = mRNA:exonerate glyph = so_transcript description = 1 bgcolor = beige category = Genes key = Exonerate predictions
After making this addition to the configuration file, reload the page and turn on "Exonerate predictions." You will see a display that is similar to the gene track, but treats each transcript as a separate feature.
As with the previous example, this depends on a recent (as of January 2008) change to bioperl. If it doesn't work for you, either update bioperl, or use the "so_transcript" glyph.
Continuing with the example from section 2.2, the third exon of EDEN.1 is shared with EDEN.3. But is the reading frame preserved? The "cds" glyph will create a display that will visualize each CDS's reading frame.
To see this work, add the following stanza to the bottom of the configuration file:
[ReadingFrame] feature = mRNA glyph = cds ignore_empty_phase = 1 category = Genes key = Frame usage
When you reload the page and turn this track on, you'll see a "musical staff" representation of the frame usage (Figure 10). From this we can see that the alternative splicing in fact changes the reading frame of the second exon.
The "feature" option tells the glyph to take its data from the mRNA subfeatures of the main gene features. Note that depending on which data adaptor you use, you may need to specify the attribute "Index=1" for each of the mRNA subfeatures in order for the glyph to find them inside the gene object. However, this is usually unnecessary.
Figure 10: The "cds" glyph shows the reading frame using a musical staff notation
In some circumstances you may wish to group features together to create a multipart feature. The gene object is actually just a special case of this. To show you the general case, we'll creature a feature of type "BAC", whose subparts are of type "clone_start" and "clone_end" (possibly corresponding to a BAC clone mapping experiment). Here is the GFF3 representation of this:
ctgA example BAC 1000 20000 . . . ID=b101.2;Name=b101.2;Note=Fingerprinted BAC with end reads ctgA example clone_start 1000 1500 . + . Parent=b101.2 ctgA example clone_end 19500 20000 . - . Parent=b101.2
As you can see, we've created a top-level feature of type "BAC" with two children of type "clone_start" and "clone_end" respectively. The start and end have opposite strands, indicating that they were sequenced off different strands of the BAC. The three features are tied together using the ID and Parent attributes that should be familiar to you from the gene examples.
This data lives in volvox5.gff3. Go ahead and add this into the database now. To visualize this add the appropriate stanza to the bottom of volvox.conf:
[Clones] feature = BAC glyph = segments bgcolor = yellow connector = dashed strand_arrow = 1 description = 1 key = Fingerprinted BACs
With this new track turned on, look at ctgA:1..24200. It will show that GBrowse has correctly picked up and rendered the relationship between the whole BAC and its two end reads (Figure 11). We have seen all these display options before with the exception of the "connector" option. This controls the appearance of the connecting line between subparts of a feature and can be one of "none", "solid", "dashed", "hat" or "quill". Try them and see what happens! (Note, you will have to change the strandedness of the BAC parent feature from "." to "+" in order to see anything special happen with the quill connector.)
Figure 11: Displaying a simple multipart feature
For your convenience, the configuration file with all the modifications made up through this point of the tutorial can be found in volvox3.conf.
GBrowse can plot quantitative data such as alignment scores, confidence scores from gene prediction programs, and microarray intensity data. The data can be displayed either with glyphs that change color to indicate score levels (see the "heterogeneous_segments", "graded_segments" and "redgreen_box" glyphs), or using a general-purpose XY-plot glyph.
Congratulations, Affymetrix has built a tiling array for the volvox genome! There's now a transcriptional profile for volvox, with an intensity reading every 100 bp across all of ctgA. The simulated data for this is in the file volvox6.gff3, an excerpt of which is shown here:
ctgA affy microarray_oligo 1 100 281 . . Name=Expt1 ctgA affy microarray_oligo 101 200 183 . . Name=Expt1 ctgA affy microarray_oligo 201 300 213 . . Name=Expt1 ctgA affy microarray_oligo 301 400 191 . . Name=Expt1 ctgA affy microarray_oligo 401 500 288 . . Name=Expt1 ctgA affy microarray_oligo 501 600 184 . . Name=Expt1 ...
The file contains 500 features, each of which is exactly 100 bp long. The features are of type "microarray_oligo" and of source "affy." Each one has a score (column 6) between 0 and 1000, where higher scores means more transcriptional activity. This is the first time we've used the score column.
All of the 500 features share the same Name (column 9) of "Expt1". Sharing the same name will allow us to group them together into a single transcriptional profiling experiment. However, we do not give them the same ID for reasons that are explained later. If we had multiple experiments to show, they would be named Expt1, Expt2 and so on.
We would like to generate a line graph that shows the transcriptional profile level across the current region. To do this, we need to group all members of the same experiment together into a single graph, and then to assign the "xyplot" glyph to the data. The following configuration stanza will do this:
[TransChip] feature = microarray_oligo glyph = xyplot graph_type = boxes fgcolor = orange bgcolor = orange height = 50 min_score = 0 max_score = 1000 scale = right category = Genes group_on = display_name key = Transcriptional Profile
The options shown here create a track named TransChip to display the tprofile feature with the xyplot glyph. The "graph_type", "height", "scale", "min_score", and "max_score" options all configure various aspects of the xyplot glyph's appearance.
You can read all about xyplot's options using perldoc Bio::Graphics::Glyph::xyplot
When you reload the page and turn on the Transcriptional Profile track, you should see something like that shown in Figure 12.
Figure 12: A transcriptional profile rendered with the xyplot glyph
Using the info that perldoc provides, play around with the xyplot options a bit. For example, see what happens when you change graph_type to "boxes."
WIG format is a specialized format for describing quantitative data. It was created by Jim Kent for use in the UCSC genome browser. Details on creating WIG files are described at http://genome.ucsc.edu/goldenPath/help/wiggle.html.
WIG files are plain text files. They always begin with a "track" header, which, at a minimum, looks like this:
track type=wiggle_0 name="ArrayExpt1" description="20 degrees, 2 hr"
The "type" attribute is required, and must have a value of "wiggle_0". "name" and "description" are optional, but suggested, and indicate the name and description of the data series -- these will become the "Name" and "Note" fields of the generated GFF3 feature. Following the track line comes the data for one or more chromosomal regions. As described in the UCSC documentation, there are three ways of formatting the data: (1)"Bed Format", (2) "variableStep", and (3) "fixedStep" format. The first format is essentially the same as GFF3 and does not give you any performance advantages over using straight GFF3. variableStep format describes intervals of the genome that have a fixed width, but begin at arbitrary locations, while fixedStep format describes features of the genome that are evenly spaced and have a fixed width (e.g. tiling array features).
For variableStep data, the format is:
variableStep chrom=chr19 span=150 59304701 10.0 59304901 12.5 59305401 15.0 59305601 17.5 59305901 20.0 59306081 17.5 59306301 15.0 59306691 12.5 59307871 10.0
The data is introduced by a line beginning with the keyword "variableStep", and the arguments "chrom" and "span", which indicate the chromosome on which the features are located, and the width of each feature, in base pairs. This is followed by a series of two-element lines indicating the start position of each feature, and its quantitative value. Values can be any sort of numeric data, including integers, negative numbers and floating point.
For fixedStep data, the format is:
fixedStep chrom=chr19 start=59307401 step=300 span=200 1000 900 800 700 600 500 400 300 200 100
The data is introduced by a line beginning with the keyword "fixedStep", and the arguments "chrom", "span", "start" and "step". The first two arguments are the same as before, while "start" and "step" indicate the starting position of the first feature, and the spacing between each feature. This is followed by a numeric value for each step. In this case, we have described 10 features beginning at position 59307401. Each feature begins 300 bp from the next and is 200 bp wide. In practice, this means that the first 200 bp of each interval is filled with known data, while information on the last 100 bp is "missing."
To see how this works in practice, let us reformat our example microarray data using the fixedStep version of WIG format. The complete data for this is in the file volvox_microarray.wig. It begins like this:
track type=wiggle_0 name="example" description="20 degrees, 2 hr" fixedStep chrom=ctgA start=1 step=100 span=100 281 183 213 191 288 ...
Compare this to the microarray data in Showing Quantitative Data (basic), and you will see that the five entries in the WIG file correspond to the first five features in the GFF3 files.
We'll now create the binary file for the data using the wiggle2gff3.pl script. First, copy the volvox_microarray.wig into the volvox database directory and then change directories (cd) into that directory. Also, delete the volvox6.gff3 file so we don't see the same set of data twice.
We want it to live in the volvox database directory, so we have to specify this path when creating it:
% wiggle2gff3.pl --path=/FRONT-END/www/html/gbrowse/databases/volvox volvox_microarray.wig \
> volvox_microarray.gff3
After this script runs, it will write out a line of GFF3 data, which we save to volvox_microarray.gff3. This file will look like this:
##gff-version 3 ctgA . microarray_oligo 1 50000 . . . Name=example;Note=20%20degrees%2C%202%20hr;wigfile=/FRONT-END/www/html/gbrowse/databases/volvox/track001.ctgA.1200440492.wig
This file contains a single feature that spans the region indicated by the WIG file. The feature has the indicated name and description, and has a new attribute "wigfile" that points to the place where the quantitative data within the region can be found. You are free to edit this file to change the source or type, You can also set the source and type in wiggle2gff3.pl by passing it --source and --type options on the command line. If you move the binary wiggle file, please change the value of the "wigfile" attribute to indicate its new location.
One last step is needed to make the data display properly, however. You must set the glyph type to either "wiggle_xyplot" or "wiggle_density." These are the only glyphs that recognize and properly format wiggle-style data. You can also remove the min and max options, since the wiggle binary files store this information internally and it is no longer needed.
In the config file, change the [TransChip] stanza to look like this:
When you reload the page, the quantitative data should display correctly. You might notice a speed improvement; this becomes much more noticeable on large data sets.[TransChip] feature = microarray_oligo glyph = wiggle_xyplot graph_type = boxes height = 50 scale = right category = Genes description = 1 key = Transcriptional Profile
Now, for some fun, change the [TransChip] section to use the "wiggle_density" glyph. Also set the bgcolor to "blue" and delete the unneeded graph_type and scale options.
[TransChip] feature = microarray_oligo glyph = wiggle_density height = 30 bgcolor = blue category = Genes description = 1 key = Transcriptional Profile
This is what the modified track will look like:
Figure 13: A transcriptional profile rendered with the wiggle_density glyph
GBrowse can take advantage of DNA sequence data in several ways:
So we've been working with feature coordinates, but no actual DNA sequence has been loaded into the volvox database. We will again rebuild the database, this time loading in a simulated DNA file in fasta format. Download the file volvox.fa, and copy it into the volvox database directory. At this point in the tutorial, when you do a directory listing of the volvox database directory (with "ls" on unix systems, or "dir/w" on Windows systems) it should look like this:
% ls /FRONT-END/www/html/gbrowse/databases/volvox/ track001.ctgA.1202327456.wig volvox2.gff3 volvox4.gff3 volvox.fa volvox1.gff3 volvox3.gff3 volvox5.gff3 volvox2b.gff3 volvox4b.gff3 volvox7.gff3 volvox_microarray.gff3
If you haven't done so already, please be sure that you have made the database directory writeable by the web server user, either by making it world writeable (as described at the beginning of this tutorial), or by changing the directory's group ownership to match the Apache web server's group account (it varies from system to system, but "nobody", "www", "apache" and "www-data" are the most common possibilities). This is all you need to do to load the DNA. To see that the DNA is indeed being loaded, add two new stanzas to the volvox.conf configuration file:
[DNA] glyph = dna global feature = 1 height = 40 do_gc = 1 gc_window = auto fgcolor = red axis_color = blue strand = both key = DNA/GC Content [Translation] glyph = translation global feature = 1 height = 40 fgcolor = purple start_codons = 0 stop_codons = 1 translation = 6frame key = 6-frame translation
The "DNA" track uses a specialized glyph called "dna". At low magnifications (zoomed way out), this glyph draws a GC content plot. At high magnifications (zoomed way in), this glyph draws the dna. Of the various options given in the example stanza, the most important one is "global feature", which is set to a true value (1). This tells GBrowse that the stanza doesn't correspond to a specific feature type, but should be displayed globally. Other options control whether to draw one or both strands, whether to draw the GC content histogram, the window size to use when smoothing the histogram, and what colors to use.
Similarly, the "Translation" track uses a glyph called "translation", which draws three or six-frame conceptual translations. At low magnifications (zoomed way out), this glyph draws little symbols indicating where start and stop codons are. At high magnifications, the actual amino acid sequence comes into view. Again, the most important option is "global feature", which is set to a true value to tell GBrowse that the track isn't attached to a particular feature type, but is to be generated automatically. Other options control the height of the glyph, whether to draw start and/or stop codon symbols, and whether to generate a 3frame or 6frame translation.
Figures 13a and 13b show the browser at low and high magnification, with both tracks activated. Notice that the coding track ("cds" glyph) notices that the DNA is available and generates the transcripts' protein translations automatically!
(14A)
![]()
(14B)
Figure 14: Viewing DNA/GC content and 6-frame translation. (a) low magnification; (b) high magnification
If you happen to do a listing of the volvox database directory after adding the DNA file, you might notice that a new file named "directory.index" has appeared. This index directory is created automatically by GBrowse in order to speed up access to the .fa file and to reduce memory requirements. If the database directory is not writable by all users, GBrowse will not be able to create this directory, and the display will be somewhat slower whenever a DNA track is turned on.
This section will lead you through creating a plausible EST track, and show you how grouping of 5' and 3' EST reads works.
We'll start with a simple data set containing information on three pairs of EST reads. You'll find this data set in volvox7.gff. Here is the first pair described in the data file:
ctgA est EST_match 1050 1500 . + . ID=Match1;Name=agt830.5 ctgA est EST_match 3000 3202 . + . ID=Match1;Name=agt830.5 ctgA est EST_match 5410 5500 . - . ID=Match2;Name=agt830.3 ctgA est EST_match 7000 7503 . - . ID=Match2;Name=agt830.3 ctgA est EST_match 1050 1500 . + . ID=Match3;Name=agt221.5 ctgA est EST_match 5000 5500 . + . ID=Match3;Name=agt221.5 ctgA est EST_match 7000 7300 . + . ID=Match3;Name=agt221.5 ...
What's going on here is the same as the alignments shown in volvox3.gff. There are two EST reads named agt830.5 (the 5' read) and agt830.3 (the 3' read). Each of them matches the ctgA genome in two discontinuous regions because, presumably, they cross a splice site. As in the earlier example, we represent each EST as a single "EST_match" feature that spans several lines. The lines are linked together by sharing the same ID attribute.
There are two other things to notice. One is that the source field (column 2) is "est" and the type (column 3) is "EST_match." Either of these fields can be used to distinguish the EST matches in this file from the generic "match" matches used in the earlier example. The second item of interest is that the strand field (column 7) is + for the 5' EST and - for the 3' EST, indicating that the 3' EST aligned to the reverse complement of ctgA.
Add this file to the volvox database directory, and add the following to the configuration file:
[EST] feature = EST_match:est height = 6 glyph = segments bgcolor = orange key = ESTs
This will give a display similar to that shown in Figure 15.
Figure 15: A simple representation of EST matches.
For reasons described earlier, the feature option reads "EST_match:est" rather than simply "match" in order to distinguish the EST matches from the example matches that we loaded previously.
This display is OK, but it could be better. One problem is that the relationship between the 5' and 3' EST read pairs is not shown. We'd like to place the two members of the pair together on the same line, and connect them with a dotted line to show that they are the two ends of the same cDNA clone. An easy way to do this is to add a "group_pattern" option to the [EST] stanza:
[EST] feature = EST_match:est glyph = segments height = 6 bgcolor = orange group_pattern = /\.[53]$/ key = ESTs
The new group_pattern option tells GBrowse to use a Perl regular expression pattern matching operation to find and group related EST matches based on their names. It helps to understand how Perl regular expressions work, but basically the pattern match breaks down this way:
/ begin the pattern match \. match a dot [53] match either the numbers 5 or 3 $ match the end of the string / end the pattern match
What this is saying is to look for pairs of EST names that are similar except for the terminal .5 or .3, and pair them. When we reload the page, we get Figure 16.
Figure 16: The group_pattern option allows EST pairs to be grouped
Here are regular expressions that will work for other common EST pairing schemes:
| 5' EST | 3' EST | group_pattern |
|---|---|---|
| agt123f | agt123r | /[fr]$/ |
| agt123p | agt123q | /[pq]$/ |
| f.agt123 | r.agt123 | /^[fr]\./ |
| 5.agt123 | 3.agt123 | /^[53]\./ |
| agt123.for | agt123.rev | /\.(for|rev)$/ |
Another nice enhancement would be to give the 5' and 3' ESTs different colors so as to distinguish one from another. This can be accomplished using a Perl callback. Open up volvox.conf once more, and find the bgcolor option in the [EST] track. Replace it with this (you may want to cut and paste from here in order to avoid introducing any typos):
bgcolor = sub {
my $feature = shift;
my $name = $feature->display_name;
if ($name =~ /\.5$/) {
return 'red';
} else {
return 'orange';
}
}
You'll need to know the basics of the Perl programming language in order to do this type of thing yourself. Suffice to say that instead of hard-coding the color "orange" into the bgcolor option, we are asking GBrowse to run a Perl subroutine each time it needs to render an EST. The subroutine is passed the feature that is about to be drawn. It asks the feature for its human-readable name (display_name) and assigns that name to a variable named $name. It then performs a pattern match on the name to see if it ends in a "5". If the name matches, the subroutine returns the color "red" to GBrowse. Otherwise it returns the color "orange."
The effect is shown in Figure 17.
Figure 17: Using a callback to distinguish 5' and 3' ESTs
The last thing we'll do with the EST data set is to add DNA to the ESTs so that at high magnification GBrowse will show the multiple alignment. This information is also used by the "dump alignments" plugin to generate a text-based multiple alignment.
NOTE: Currently only nucleotide to nucleotide alignments can be displayed at the level of individual nucleotides (e.g. BLASTN, BLAT, Exonerate). Protein to nucleotide alignments, such as those produced by Genewise or BLASTX, are not supported at the residue level
To make this work, we need to add two additional pieces of information to the EST alignment data:
ctgA 1050 gattgccattgaccttggccattggccaagctgaa 1086
|||||||||| ||||||| ||||||||||||||||
agt830.5 1 gattgccattcaccttgggcattggccaagctgaa 135
What we currently have in the GFF file are the source genomic positions of the alignments (in ctgA-relative coordinates). We need to add the target positions in agt830.5-relative coordinates in order for GBrowse to fetch and display the appropriate segments of the EST DNA.
The fasta file ests.fa provides the DNA sequences for the six EST reads. The GFF load file volvox8.gff contains the revised coordinates. If you look at this file you'll see that it is dissimilar to previous load files:
ctgA est EST_match 1050 1500 . + . ID=Match1;Name=agt830.5;Target=agt830.5 1 451 ctgA est EST_match 3000 3202 . + . ID=Match1;Name=agt830.5;Target=agt830.5 452 654 ctgA est EST_match 5410 5500 . - . ID=Match2;Name=agt830.3;Target=agt830.3 505 595 ctgA est EST_match 7000 7503 . - . ID=Match2;Name=agt830.3;Target=agt830.3 1 504 ctgA est EST_match 1050 1500 . + . ID=Match3;Name=agt221.5;Target=agt221.5 1 451 ctgA est EST_match 5000 5500 . + . ID=Match3;Name=agt221.5;Target=agt221.5 452 952 ctgA est EST_match 7000 7300 . + . ID=Match3;Name=agt221.5;Target=agt221.5 953 1253 ...
The first eight columns are identical to what we've been using before, but the ninth column follows a new convention used for nucleotide to nucleotide and protein to nucleotide alignments. There is now a special attribute, "Target", that tells GBrowse specifies the name of the EST sequence (found in a FASTA file), the start position of the alignment in EST coordinates, and the end position of the alignment in EST coordinates. the combination of a target sequence and its coordinates. For example, the first segment of the first alignment, agt830.5, spans positions 1050 to 1500 in genome coordinates, and positions 1-451 in EST sequence coordinates.
There is a subtlety here. Notice that for minus strand ESTs, the target coordinates are not reversed; the start position is always less than the end position. For example, for the first agt830.3 HSP, we are told that genomic region 5410..5500 aligns to EST region 505..596. The strand field is used to determine the direction of the alignment.
Since this data file contains a revised version of volvox7.gff, remove volvox7.gff3 from the database directory and replace it with volvox8.gff . Also copy ests.fa into the database directory. If you perform a directory listing, it should look like this:
directory.index volvox1.gff3 volvox2.gff3 volvox4b.gff3 volvox5.gff3 volvox8.gff3 ests.fa volvox2b.gff3 volvox3.gff3 volvox4.gff3 volvox6.gff3 volvox.fa
NOTE: If you see doubled EST features after this point, make sure that you have removed volvox7.gff. Another thing to watch out for is that some sort of bug in the BioPerl layer (up through at least version 1.4) causes the EST DNA display to get messed up at this point on Windows systems. To fix the latter problem, go to the volvox database directory and remove the files directory.dir and directory.pag. These are automatically-generated DNA file indexes that GBrowse develops, and will be regenerated for you the next time you access a page.
We're not done with making configuration file changes, but volvox4.conf contains all configuration file enhancements up to this point. If you like, you can copy it over the live volvox.conf. It contains the following version of the [EST] track:
[EST]
feature = EST_match:est
glyph = segments
height = 6
draw_target = 1
show_mismatch = 1
canonical_strand = 1
bgcolor = sub {
my $feature = shift;
my $name = $feature->display_name;
if ($name =~ /\.5$/) {
return 'red';
} else {
return 'orange';
}
}
group_pattern = /\.[53]$/
key = ESTs
The key addition to this track configuration is the "draw_target", "show_mismatch" and "canonical_strand" options. All options are true/false flags, where 0 means false and 1 means true. draw_target tells the segments glyph to draw the DNA sequence of the target ESTs when the magnification allows. show_mismatch instructs the glyph to highlight mismatches between the genome and the EST in pink. canonical_strand instructs the glyph to display the plus strand sequence even when the EST matches the minus strand.
To see this work, reload the page, turn on the EST track and search for region "ctgA:1065..1165". This will show the aligned 5' ends of agt221.5, agt830.5 and agt767.5 (Figure 18). Notice that one of the T's towards the beginning of agt830.5 is highlighted to show that it doesn't match the corresponding genomic base.
Figure 18: Multiple alignments at the DNA level
If you don't see the EST sequence appearing, make sure that ests.fa is in the volvox database directory and is world readable. If it still isn't working, you may need to "touch" the file in order to update its modification date. This tells GBrowse that it is new and needs to be reindexed. In Unix:
% touch /FRONT-END/www/html/gbrowse/databases/volvox/ests.fa
If you are still having problems, remove the directory.index file completely in order to force reindexing.
If you have sequence trace information (in SCF format) associated with the reference sequence, this can be displayed in gbrowse using the trace glyph. To use this glyph, you must have installed:
The data file volvox9.gff3 contains an example trace entry.
ctgA example trace 44401 45925 . + . Name=trace;trace=volvox_trace.scf
This aligns the full trace sequence to the reference sequence. The trace file in this case is named "volvox_trace.scf", and it is located in /FRONT-END/www/html/gbrowse/tutorial/data_files/volvox_trace.scf.
Due to sequence quality, the first few bases of a trace file usually don't align. Even so, these need bases need to be included in the gff file. For instance, if the bases 10-700 of the trace file aligns to the bases 100-800 of the reference sequence, the feature would be 90-800 to account for the first 10 bases (starting at base 0).
NOTE: The trace glyph currently doesn't deal with insertions or deletions. If an indel occurs, the alignment after the indel will be off.
Copy this file into the volvox database directory. Then, to display the trace, copy the following into the volvox.conf (or copy volvox5.conf over the current volvox.conf file).
[Traces] feature = read glyph = trace fgcolor = black bgcolor = orange strand_arrow = 1 height = 6 description = 1 a_color = green c_color = blue g_color = black t_color = red show_border = 1 trace_height = 80 trace_prefix = http://localhost/gbrowse/tutorial/data_files/ key = Traces
The fgcolor, bgcolor, strand_arrow and height control the bar that shows the location and directionality of the trace.
The trace_prefix option is important because it gives the path to the trace files. This is prepended to the trace file name defined in the gff file. It can be a direct path to the directory (eg "/usr/local/trace_files/") or a web address (as above).
The a/c/g/t_color options allow configuration of the base colors. The trace_height refers to the height of the trace itself. Play around with it to find a height that you like.
If show_border is set to 1, a black box will be drawn around the trace.
After configuring the trace glyph, reload the browser page and enable traces. Zoomed out you will see:
Figure 19: The trace glyph zoomed out.
Zooming in will show you the trace diagram:
Figure 19: The trace glyph zoomed in.
In this section of the tutorial we'll discuss customizing the look and feel of GBrowse by adding a region view section, adding feature tracks to the region view and/or overview sections, configuring semantic zooming, and adding functionality with plugins.
The overview is the scale that appears at the top of the detailed image. It always shows the entire reference sequence, whether it be a chromosome, a contig or a clone. With larger genomes, you may want to supplement the overview with a "region panel" that is intermediate in size between the overview panel and the detail panel. The region panel can contain tracks of its own and is useful for displaying features that are too numerous for the overview panel and too large for the detail panel.
Open the volvox.conf configuration file and add the following line to the [GENERAL] section. A good place is near the "max segment" and "default segment" sections:
# max and default segment sizes for detailed view max segment = 50000 default segment = 5000 # size of the "region panel" region segment = 20000
Now when you reload the volvox page, you will see an intermediate panel labeled "region", as shown in Figure 20:
Figure 20: The "region" panel shows a region intermediate in size between the overview and the detail panel.
You can declare region panel tracks in exactly the same way that you declare overview tracks by declaring stanzas qualified by ":region"
[TransChip:region] feature = tprofile glyph = xyplot graph_type = boxes height = 50 min_score = 0 max_score = 1000 bgcolor = blue scale = right key = Profile
Figure 21 shows what the region looks like with its "Profile" track turned on.
Figure 21: You can add any number of tracks to the region panel, just as you would for the overview panel.
In many cases it is handy to add tracks directly to the overview and/or region panel. These tracks can be turned on and off just like normal tracks, and can serve as reference points for well-known genes, cytogenetic bands, or genetic markers.
We will illustrate how to do this by placing a copy of the Motifs track into the overview. Add the following to the bottom of the volvox.conf configuration file:
[Motifs:overview] feature = polypeptide_domain glyph = span height = 5 description = 0 label = 1 key = Motifs
This stanza is identical to the [Motifs] track that we created earlier, except that its name is qualified with ":overview". This tells GBrowse that this is not an ordinary track to be placed in the detail image, but one that should be placed in the overview.
We also want the overview motifs track to be displayed by default, so go to the top of the configuration file, and modify the "default features" option to look like this:
# list of tracks to turn on by default default features = ExampleFeatures Motifs:overview
Reload the page. Violá! See Figure 22.
Figure 22: Any number of tracks can be placed in the overview
You can add as many tracks to the overview as you like. The main warning is that if you add lots of features to the overview it can get pretty crowded in there. Performance can also suffer, since each feature must be fetched and rendered each time the overview is displayed.
To add a track to the region panel, simply replace ":overview" with ":region" in the track stanza:
[Motifs:region] feature = polypeptide_domain glyph = span height = 5 description = 0 label = 1 key = Motifs
One of the cooler features of GBrowse is its ability to support semantic zooming. Semantic zooming is a feature in which objects show different levels of detail depending on the level of magnification. We've already seen this behavior in the "dna" and "segments" glyphs, which show the DNA sequence only when there's sufficient room to display it.
GBrowse has several types of semantic zooming:
The thresholds for labeling and bumping are set by configuration options named "label density" and "bump density" respectively. The standard values can be found in the defaults track named [TRACK DEFAULTS]. They are originally set so that labels are suppressed when there are more than 25 features per track, and bumping is suppressed when there are more than 100 features per track. You can these values globally by editing their values in [TRACK DEFAULTS], or you can add "label density" and/or "bump density" options to individual track configuration sections in order to override the settings for specific tracks.
The process of setting up semantic options is a bit more interesting. To illustrate, we will create semantic zooming for the [Alignments] track ("Example Alignments"). We would like the track to shift from showing the individual segments to showing solid rectangles when the user is zoomed out to 30K and beyond, and turn bumping off when the user is zoomed out to 45K and beyond. The process is simple. Beneath the [Alignments] stanza, we add a stanza qualified for zoomlevels of >= 30,000 and another stanza qualified for zoomlevels of >= 45,000:
[Alignments] feature = match glyph = segments key = Example alignments [Alignments:30000] glyph = box label = 0 [Alignments:45000] glyph = box bump = 0 label = 0
The format for semantic options is [Trackname:distance], where Trackname must be the same as the non-qualified track, and distance is the length of the region at which the semantic options will kick in. Only options that are different from the non-qualified track need to be listed. According to the configuration given above, when the user is looking at a region 30,000 bp or longer, the glyph option will change to "box," which is a solid rectangle that doesn't show any internal details. All other options, such as feature and key, will be inherited from the [Alignments] track.
At 45,000 bp, the glyph is again set to box, and in addition the "bump" option is set to zero, turning off collision control. Notice that options are inherited from the unqualified track stanza, and not from the previous semantic zoom level. If we had neglected to specify the glyph option in [Alignments:45000], the glyph would have reverted to "segments."
Make these changes to volvox.conf, turn on the "Example Alignments" track, and view the contig at 20K, 40K and 50K. At 40K, you'll see the alignments lose their internal structure and be replaced by solid boxes (Figure 23). At 50K they'll begin to overlap and the feature labels will be suppressed.
Figure 23: Semantically zoomed alignments at 40K
The bottom of the GBrowse window contains an expandable set of checkboxes that allows the users to turn tracks on and off. By default, the tracks are grouped into sections corresponding to tracks belonging to the overview panel, those belonging to the region panel, tracks created by external (third-party) annotations, and tracks created by plugins. All other tracks are grouped together in a catch-all section named "General."
You can easily define new track groups to make navigation easier. To do so, just add a "category" option to each of the track stanzas. This option defines the name of the category. Tracks that belong to the same category will be grouped together, regardless of the order in which the track definitions appear in the configuration file. For example, we can place the [Motifs] and the [Translation] tracks into a section named "Proteins" by modifying their stanzas to look like this:
[Motifs] feature = polypeptide_domain glyph = span height = 5 description = 1 category = Proteins key = Example motifs [Translation] glyph = translation global feature = 1 height = 40 fgcolor = purple start_codons = 0 stop_codons = 1 category = Proteins translation = 6frame key = 6-frame translation
In this way we can create sections named "Alignments," "Examples," "Genes" and "Proteins" and assign the appropriate tracks to them. The Tracks control section will look something like Figure 24:
Figure 24: You can add any number of tracks to the region panel, just as you would for the overview panel.
The file volvox_final.conf contains the final configuration file with all the modifications we've made during the course of this tutorial. The data files volvox_all.gff and volvox_all.fa likewise contain the entirety of the feature and DNA data.
A further refinement to display track information within the category is a table display with headings for the rows and columns (see Figure 25 for an example). This layout is useful for displaying data that highlights the experimental design as in microarray or ChIP-on-Chip experiments.
Figure 25: An example of a category table containing a 9 track table, organized as 3 rows x 3 columns each with a heading.
This was constructed by adding an option named "category tables" to the [GENERAL] section. The first argument in this option refers to the category you wish to add the table to, the second is a space separated list of column headings, the third a space separated list of row headings.
It is then important that your stanzas within the category are in column followed by row order (see example below and compare with Figure 25). So stanza 1 is column 1/row 1, stanza 2 is column 1/row 2, stanza 3 is column 1/row 3, stanza 4 is column 2/row 1, stanza 5 is column 2/row 2 etc. This means each cell in the table must have a stanza. Any surplus tracks within that category will be ignored. For example if there was a stanza 10, this would not be shown. If there are empty tracks they can be disabled using the 'disabled = 1' option in the stanza. So to display the category table in figure 27 you would use the following configuration.# category table configuration category tables = 'ArrayExpts' 'strain-A strain-B strain-C' 'temperature anaerobic aerobic'
[temp_strainA] category = ArrayExpts feature = temp_strainA_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Temp strain A (1 expt) [anaerobic_strainA] category = ArrayExpts feature = anaerobic_strainA_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Anaerobic Strain A (0 expt) disabled = 1 [aerobic_strainA] category = ArrayExpts feature = aerobic_strainA_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Aerobic Strain A (0 expt) disabled = 1 [temp_strainB] category = ArrayExpts feature = temp_strainB_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Temp strain B (2 expts) [anaerobic_strainB] category = ArrayExpts feature = anaerobic_strainB_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Anaerobic Strain B (0 expt) disabled = 1 [aerobic_strainB] category = ArrayExpts feature = aerobic_strainB_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both title = blah key = Aerobic strain B (3 expts) [temp_strainC] category = ArrayExpts feature = temp_strainC_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Temp strain C (1 expt) [anaerobic_strainC] category = ArrayExpts feature = anaerobic_strainC_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Anaerobic strain C (3 expts) [aerobic_strainC] category = ArrayExpts feature = aerobic_strainC_agg glyph = xyplot bgcolor = red neg_color = green fgcolor = black graph_type = boxes height = 80 min_score = -2.0 max_score = 2.0 scale = both key = Aerobic strain C 3 (2 expts)
If you need to have multiple category tables, simply use continuation lines for the "category tables" option:
# category table configuration
category tables = 'ArrayExpts' 'strain-A strain-B strain-C' 'temperature anaerobic aerobic'
'CHiP-Chip' 'TFX1 ONE-CUT PHA4' '16-cell-stage 320-cell-stage adult'
Another cool GBrowse feature is its ability to take advantage of plugins, which are small modules of Perl code that extend GBrowse in various ways. In this section, we will show how to activate two popular plugins, RestrictionAnnotator and Aligner. The first generates a track of restriction sites. The second dumps a text-based multiple alignment of the current region on view.
To see these plugins at work, first make sure that the database files are up to date with this position in the tutorial. If you are in any doubt, remove the current contents of the volvox database directory and replace them with the files volvox_all.gff3 and volvox_all.fa.
Now find the option "plugins=" at the top of volvox.conf, and modify it to activate the Aligner and RestrictionAnnotator plugins:
plugins = Aligner RestrictionAnnotator
When you reload the page, you will see a new popup menu appear under the image labeled "Dumps, searches and other operations." You will also see an automatic track labeled "plugin:Restriction Sites" appear in the track list. When you turn on this track, you will be presented with a restriction map (Figure 26). You can then adjust which restriction sites are shown by selecting "Annotate Restriction Sites" from the popup menu and pressing the "Configure" button.
Figure 26: The RestrictionAnnotator Plugin
To see the Aligner at work, center your view on a region that contains the EST alignments (for example, ctgA:1000..5000), select "Dump Alignments" from the plugin popup menu, and press "Go". This will return a text-based multiple alignment of the genome and the EST tracks.
The Aligner plugin has some additional configuration that you can perform. We'll look at this now as an example of how to configure plugins. Open up volvox.conf and add the following configuration section:
######################## # Plugin configuration ######################## [Aligner:plugin] alignable_tracks = EST upcase_tracks = CDS Motifs upcase_default = CDS
It doesn't matter where the section goes, but it is probably a good idea to place this towards the middle of the file after the [GENERAL] section (at the top) and before the [TRACK DEFAULTS] section. Otherwise it is easy for you or someone else maintaining the configuration file to mistake this for some sort of track configuration.
Plugin configuration sections are distinguished from track configuration by having names of the format PluginName:plugin. In this case, the three configuration options are applied to the Aligner plugin. For the Aligner plugin, the configuration options are:
| Option | Description |
|---|---|
| alignable_tracks | Space-delimited list of tracks to include in the multiple alignment. The genome is always included. If this option is not present, then GBrowse will automatically include any track that has the "draw_target" option set. |
| upcase_tracks | Space-delimited list of tracks that will be used to UPCASE the genomic DNA. This is very useful if you want to embed the positions of coding regions or other features inside the multiple alignment. Uppercasing will not be turned on by default. The user must press the "Configure" button, and select which of the uppercase tracks are to be activated from a list of checkboxes. |
| upcase_default | A space-delimited list of tracks that will be uppercased by default unless the user turns them off during configuration. |
| ragged_default | A small integer indicating that the aligner should include some unaligned bases from the end of each sequence. This is useful for seeing the sequencing primer or cloning site in ESTs. |
With the changes in place, select the aligner from the popup menu and press Configure. Turn on uppercasing of the coding region track and see how it affects the display (Figure 27).
Figure 27: The Aligner plugin produces multiple alignments.
Plugin files live in /FRONT-END/www/conf/gbrowse.conf/plugins. To view plugin documentation, find the plugin file, which usually lives under gbrowse.conf/plugins, and run the perldoc command with the -F ("file") option:
% perldoc -F Aligner.pm
Here's the list of plugins that come with the standard distribution:
| Plugin | Description |
|---|---|
| Aligner | Dump multiple alignments |
| AlignTwoSequences | Execute NCBI's bl2seq on the current view (requires the bl2seq executable). |
| AttributeHiliter | Highlight (by colorizing) features whose attributes match some user-specified values. |
| BatchDumper | Allows the user to cut and paste a series of landmarks on the genome and dumps out all overlapping features using a variety of formats (e.g. GenBank format) |
| Blat | Plugin to align sequences against the genome using the BLAT algorithm (requires BLAT executable). |
| CMapDumper | Produces files that can be read by the CMap comparative map browser. |
| CreateBlastDB | Creates a Blast-formatted database from a GBrowse database. |
| FastaDumper | Produce pretty-printed FASTA dumps of the current region, with selected features highlighted with colors or font styles. |
| FilterTest | Small demonstration of how to write a plugin that filters features (makes them visible or invisible) based on arbitrary criteria. |
| GeneFinder | Runs Phil Green's genefinder gene prediction program within GBrowse (requires genefinder executable). |
| GFFDumper | Dump out the current region in GFF format (redundant with BatchDumper). |
| OligoFinder | Lets the user search for landmarks on the basis of unique 11-mers or greater. |
| PrimerDesigner | Interactively design PCR primers (requires primer3 executable). |
| ProteinDumper | Dump translated protein sequences of the current region in various formats |
| RandomGene | Small demonstration of how to connect a plugin to a gene prediction program. Doesn't actually predict genes, but generates simulated ones. |
| RestrictionAnnotator | Creates restriction maps. |
| Spectrogram | Generate DNA spectrograms to highlight low complexity regions, repetitive regions, coding regions and other regions with periodicity. Requires Math::FFT Perl module. |
| Submitter | Helper plugin for the rubber-band select menu. See GBrowse Rubber-band selection. |
| test | This dumps the current view in FASTA format, and is used for regression testing the plugin architecture. |
It is often useful to have independent annotation data sets that can be visualized together but updated separately. For example, you may be working on a genome that has a core set of stable annotations that everyone shares, such as the set of protein-coding genes, and independent sets of annotations that change frequently, such as promoter predictions and experimental data.
GBrowse provides several mechanisms for making this type of modular annotation possible. You can:
This section will lead you through the various ways to view third party annotations on top of GBrowse. The examples are somewhat contrived since we only have one computer to work with, and by necessity both the main data and the third-party feature data will have to reside on the same computer. Don't be confused by this, and keep in mind that in the real world, GBrowse will be running on one computer, and the third-party annotation data will be loaded from another network-accessible computer.
First, we'll look at how to upload private tracks to the browser. This method is intended for users who wish to view their own data in the context of the genome, and don't want to share the track with others.
Instead of using the artificial volvox data, we will now use some real genome annotations from the C. elegans genome project. This is a region around C. elegans cosmid C01F4. The core data that we'll be using is contained in the files elegans_core.gff3, and elegans.fa.
Refer back to the beginning of the tutorial now and create a GBrowse database directory named "elegans_core". Then copy elegans_core.gff3, and elegans.fa into it. The configuration file to use is elegans_core.conf. Place it in /FRONT-END/www/conf/gbrowse.conf/.
Confirm that you can browse the database. Figure 28 is a picture of the entire data set with all core tracks turned on.
Figure 28: The core C. elegans dataset.
We will now add some third-party annotations to the display. These are contained in the files "elegans_acceptor.gff3", "elegans_expression.gff3", "elefans_sts.gff3", "elegans_deletion.gff3", and "elegans_repeats.gff3":
| elegans_acceptor.gff3 | Annotations of C. elegans spliced leader acceptor sites. |
| elegans_expression.gff3 | Positions assayed for gene expression level in C. elegans microarrays. |
| elegans_sts.gff3 | Primer pairs available for the region produced by the C. elegans ORFeome project. |
| elegans_deletion.gff3 | Deletion endpoints from a targeted gene knockout project. |
| elegans_repeats.gff3 | Complex repetitive elements found using the RepeatMasker program. |
We can load each of these files to private storage located on the server using the file upload feature. Copy these five files to your home directory where you can find them easily. Go to the section marked Upload your own annotations and choose the "Browse..." button. Select one of the annotation files, and then press the "Upload" button to upload the file to the server. The annotations contained in the file should now appear on the display. If you now do this for all five of the annotation files, you will eventually get a display like that shown in Figure 29.
Figure 29: After uploading four annotation files.
NOTE: This upload function works even if the gbrowse you are uploading to is located on a remote server. The uploaded files are stored in a private directory on the server away from the main data set. Other users cannot see your data.
Although this display is functional, there is no difference between the appearance of each of the tracks. Fortunately, we can customize the uploaded files quite easily. Let us change the "elegans_sts.gff3" file so that the primer pairs use the "primers" glyph. We can either do this by deleting the uploaded file, making the appropriate modification to our local version and then reuploading it, or by editing the file in place. We'll take the latter course.
Scroll to the bottom of the browser window, find the uploaded file named "elegans_sts.gff3", and choose "Edit File...".
Figure 30: The uploaded files can be edited in place by clicking the "Edit File..." button.
This will take you to a simple text editor window. At the top of the window, add the following configuration stanza:
# edited elegans_sts.gff3 file [Orfeome Primers] feature = reagent glyph = primers height = 6 key = ORFeome project primer pairs
When you are done, press "Submit Changes..." and the display will be updated to show the track with a more readable track name and the primers glyph.
If you like, you can customize each of the files. Here is a suggested set of customizations:
# for the file elegans_repeats.gff3 [Repeats] feature = repeat bgcolor = white key = Complex repeats # for the file elegans_acceptor.gff3 [Acceptors] feature = trans-splice_acceptor_site glyph = diamond bgcolor = red key = Trans-splice Acceptors # for the file elegans_deletion.gff3 [Deletions] feature=deletion glyph = span key = Gene knockouts # for the file elegans_expression.gff3 [Expression] feature = microarray_oligo bgcolor = orange height = 4 key = Microarray expression probe
With this combination of configurations, the display will now look as shown in Figure 31:
Figure 31: After customizing the annotation files.
NOTE: Be aware of an important difference between the track configuration of the uploaded files and of the main GBrowse configuration files. In GBrowse, the [STANZA] heading is the name of the symbolic name of the track, and particular feature types are added to the track using the feature= option. In uploaded files, the [STANZA] heading is the feature type itself. This means that each track can only contain one feature type. However, any uploaded GFF file can contain multiple feature types, and each feature type can have its own configuration stanza.
The other important difference between the uploaded file configuration and the GBrowse main configuration is that for security reasons Perl subroutines are not allowed in the configuration sections of uploaded files. However links and link patterns are allowed.
There is no particular reason that each of the annotation sets were broken into separate files. We could easily combine them into a single GFF file just as you do for the core annotations.
Once you have an uploaded annotation file set up the way you like it, you might want to share it with others. You can do this easily if you have access to an anonymous FTP or web server (if you are reading this tutorial, it is fair to assume that you do!)
To watch this in action, we will place one of the annotation files onto the local web server and then load it from within the local GBrowse. This contrived example doesn't make much sense until you realize that the same trick will work when the GBrowse server and the web-accessible annotation file can be on separate machines halfway across the world.
We will demonstrate using the elegans_sts.gff3 file. Please use a version that has been edited to place the [reagent] configuration stanza at the top. Then copy this file to the directory "/FRONT-END/www/html". This will place it at the top of the Web server document tree, but outside the location of GBrowse databases. Check that the file is correctly installed on your web server by fetching this URL: http://localhost/elegans_sts.gff3. If the file is correctly installed on the Web server, you will see this:
[Orfeome Primers] feature = reagent glyph = primers height = 6 key = ORFeome project primer pairs ##gff-version 3 ##date Tue Feb 24 06:39:41 2004 ##source gbrowse GFFDumper plugin ##NOTE: Selected features dumped. C01F4 Orfeome_project reagent 3319 17668 . + . Name=mv_ZK783.1;amplified=0 C01F4 Orfeome_project reagent 18584 20445 . - . Name=mv_G_YK5686;amplified=1 C01F4 Orfeome_project reagent 24509 25425 . - . Name=mv_ZK783.3;amplified=1 C01F4 Orfeome_project reagent 26525 33359 . - . Name=mv_ZK783.4;amplified=0 C01F4 Orfeome_project reagent 38660 49506 . + . Name=mv_C18H2.1;amplified=1
Now go back to your browser, and delete all the uploaded files. (This is to prevent the list of tracks from getting too long!) You can do this by scrolling to the bottom of the browser window and pressing "Delete File" for each of the annotation files that you previously uploaded. This should return you to the display of the core gene models and EST alignments that we began with.
Now we'll reload the STS annotations by using their URL. Scroll to the bottom of the window, find the text field labeled "Enter Remote Annotation URL", type in http://localhost/elegans_sts.gff3, and press "Update URLs." The "ORFeome project primer pairs" track will reappear.
In order to make this process even simpler, you can create a popup menu containing the URLs of frequently-accessed remote annotation files. To make this more interesting, first copy the elegans_expression.gff3 file to the "/FRONT-END/www/html" directory in the way described earlier. Now elegans_sts.gff3 and elegans_expression.gff3 will be available as the URLs http://localhost/elegans_sts.gff3 and http://localhost/elegans_expression.gff3, respectively.
Open up the GBrowse configuration file, "/FRONT-END/www/conf/gbrowse.conf/elegans_core.conf", and insert the following lines right after the "plugins =" line:
# remote GFF files to make available for optional loading remote sources = "ORFeome STSs" http://localhost/elegans_sts.gff3 "Expression probes" http://localhost/elegans_expression.gff3
When you reload the web page, you will see a popup menu appear next to the remote annotation URL textfield (Figure 32). The menu will contain options to load "ORFeome STSs" and "Expression probes", and selecting a menu item will have exactly the same effect as typing in the URL manually.
The neat thing about all this is that it works across the Internet. Send the URL of the annotation files to your colleagues (being sure to replace "localhost" with the hostname of your web server!) and they'll be able to load this URL into any GBrowse that uses the same core annotations. You can also use this mechanism within your laboratory or department to share annotation sets without having to give everyone write access to the web server's /FRONT-END/www/html directory.
Figure 32: The preset remote annotation URL popup menu.
To remove a URL from the list of loaded URLs, just delete it from its text field and reload.
The Distributed Annotation System protocol (DAS; http://www.biodas.org) is a system for exchanging genomic annotations across the Internet. It works similarly to the idea of sharing the URLs of web-accessible GFF files, except that it is designed to support large data sets. When a client application needs to fetch just a subset of the data, such as a small piece of a chromosomal arm, the DAS protocol allows only the relevant annotations to be retrieved, rather than the whole data set.
To take advantage of DAS functionality, you will have to install the Perl Bio::Das module. This is available from CPAN (the Comprehensive Perl Archive Network (http://www.cpan.org) or from the GMOD PPM repository. Unix users can install Bio::Das with this command:
% perl -MCPAN -e 'install Bio::Das'
Windows users can use the PPM tool:
You may need to issue the command "rep add gmod http://www.gmod.org/ggb/ppm" if PPM complains that it cannot find Bio::Das.C:\Windows> ppm ppm> install Bio::Das ppm> quit
When you installed GBrowse, you also installed a CGI script that enables your web server to act as a DAS server. The CGI script is named "/FRONT-END/www/cgi-bin/das", and it runs off the same configuration files as GBrowse itself. Only a very small bit of extra configuration is required to enable full DAS server functionality. In this part of the tutorial we will first turn on the DAS server, and then use it to serve out annotations on the C. elegans database.
To start, open the elegans_core.conf configuration file and add the following line to the configuration file. It can go anywhere before the start of the track definition stanzas, but it is probably a good idea to place it towards the top between "plugins" and "default features."
# DAS reference server das mapmaster = SELF
What this line is doing is to declare to the DAS system that our server is authoritative for the coordinates on the current C. elegans genome example. This is appropriate if you are starting out a genome for the first time. If, however, you want to annotate against an existing set of genome coordinates, you should replace SELF with the URL of the DAS reference server that serves that genome. For example release hg16 of the human genome at UCSC corresponds to DAS URL http://genome.cse.ucsc.edu/cgi-bin/das. A list of reference servers for various model organisms can be found at http://www.biodas.org.
The next step is to go through the configured tracks and add a "das category" to each of them. DAS uses the idea of the "category" of a feature in order to filter sets of features by their purpose. Categories include:
| transcription | features that have to do with RNA transcription |
|---|---|
| translation | features that have to do with protein translation and function |
| variation | mutations, deletions, polymorphisms |
| structural | contigs, clones, reads, PCR primers |
| repeat | repetitive elements |
| experimental | a catch-all for experimental data |
| miscellaneous | anything that doesn't fit in one fo the other categories |
Find the [Transcripts] stanza and modify it to to have a das category of "transcription" as shown here:
[Genes] feature = gene glyph = gene height